Language
ログイン
言語設定
X
English
日本語 [Japanese]
アプリの説明へ
MotifMinCircadian
いいね!
0
Loading...
MotifMinCircadian = function(containerId, options) { new Application.motifMinCircadian(containerId, options); }; if (Application === "undefined" || !Application) { var Application = {}; } // Application.motifMinCircadian method Application.motifMinCircadian = function() { this._init.apply(this, arguments); }; Application.motifMinCircadian.prototype = { // Initialization _containerId : null, _baseSequence : null, _options : null, _motifProperty : null, _heptamer : null, _octamer : null, _appSequence : null, _filteredSubjectList : null, _motifViewDialogId : null, _default : { appName : "MotifMinCircadian", selectRangeCaption : "Select Range", selectPropertyAreaClass : "selectPropertyArea", selectPropertyClass : "selectProperty", resultAreaClass : "resultArea", replaceButtonAreaClass : "replaceButtonArea", replaceButtonClass : "replaceButton", nextButtonAreaClass : "nextButtonArea", replaceSequenceClass : "replaceSequence", errorMessageAreaClass : "errorMessage", dialogErrorMessageClass : "dialogErrorMessage", dialogOutRangeValueMessage : "Please input a value between {0} and {1}", noSequenceForThisRange : "No sequence found for this range", databaseInfoClass : "databaseInfo", motifSequenceProperty : "motif sequence", motifPositionProperty : "motif position", sinePhaseProperty : "Sine Phase", sineAmplitudeProperty : "Sine Amplitude", typeProperty : "type", validType : "REG", motifViewDialogId : "motifViewDialog", motifViewDialogClass : "motifViewDialog", motifViewDialogTitle : "Motif View", minSequenceClass : "minSeq", maxSequenceClass : "maxSeq", websiteNameAtted : "ATTED", websiteNamePpdb : "PPDB", baseSequenceMinLength : 50, dialogImageUrl : "http://app.linkdata.org/asset/0aea5a0d.png", callback : function() {} }, _init : function(containerId, options) { this._containerId = containerId; this._options = $.extend({}, this._default, options); this._baseSequence = this._options.baseSequence; this.filteredSubjectList = []; this._initMotifProperty(this._options); this._initAppSequence(this._options); this._initHeptamer(); this._initOctamer(); this._initFiltering(this._options); this._initView(); this._initListener(); this._initMotifViewDialog(); }, _initMotifProperty : function(opts) { var obj = { workId : opts.workId, fileName : opts.fileName }; this._motifProperty = new Application.motifProperty(obj); }, _initAppSequence : function(opts) { var seqProperty = this._motifProperty.getPropertyByLabel(this._options.motifSequenceProperty); var posProperty = this._motifProperty.getPropertyByLabel(this._options.motifPositionProperty); var obj = { workId : opts.workId, fileName : opts.fileName, baseSequence : this._baseSequence, motifSequenceProperty : seqProperty, motifPositionProperty : posProperty, containerId : this._containerId, errorMessageClass : this._options.errorMessageAreaClass, baseSequenceMinLength : this._options.baseSequenceMinLength }; this._appSequence = new Application.sequence(obj); }, _initHeptamer : function() { this._heptamer = new Application.heptamer(); }, _initOctamer : function() { this._octamer = new Application.octamer(); }, _initView : function() { this._initMainView(); this._initDialogView(); }, _initMainView : function() { var self = this; var optionArray = this._motifProperty.getOptionArray(); var sb = []; sb[sb.length] = "<div class='" + this._options.selectPropertyAreaClass + " row'>"; sb[sb.length] = "<div class='label left'>" + this._options.selectRangeCaption + "</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<select class='" + this._options.selectPropertyClass + "'>"; sb[sb.length] = "<option value='-1'>-- Select Range --</option>"; sb[sb.length] = "<option value='0-4'>0 to 4</option>"; sb[sb.length] = "<option value='4-8'>4 to 8</option>"; sb[sb.length] = "<option value='8-12'>8 to 12</option>"; sb[sb.length] = "<option value='12-16'>12 to 16</option>"; sb[sb.length] = "<option value='16-20'>16 to 20</option>"; sb[sb.length] = "<option value='20-24'>20 to 24</option>"; sb[sb.length] = "</select>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='" + this._options.resultAreaClass + " hidden'></div>"; sb[sb.length] = "<div class='" + this._options.replaceButtonAreaClass + " hidden'>"; sb[sb.length] = "<a class='" + this._options.replaceButtonClass + " btn btn-lightblue'>Replace</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='" + this._options.databaseInfoClass + " hidden'></div>"; sb[sb.length] = "<div class='" + this._options.replaceSequenceClass + " hidden'></div>"; sb[sb.length] = "<div class='" + this._options.errorMessageAreaClass + " hidden'>error</div>"; $("#" + this._containerId).append(sb.join("")); }, _initDialogView : function() { var sb = [], self = this, date = new Date(); this._motifViewDialogId = "motifViewDialog_id_" + self._containerId; sb[sb.length] = "<div id='" + this._motifViewDialogId + "' class='hidden'>"; sb[sb.length] = "<input type='hidden' class='sequence'>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Place motif at position</span>"; sb[sb.length] = "<input type='text' class='position'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Replace with prefer position between "; sb[sb.length] = "<span class='minSeq'></span> and <span class='maxSeq'>"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Number of extra copies</span>"; sb[sb.length] = "<input type='text' class='extraCopies' value='0'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Space between copies (Base Pairs)</span>"; sb[sb.length] = "<input type='text' class='basePairs' value='0'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='motifImageArea'>"; sb[sb.length] = "<img src='" + this._options.dialogImageUrl + "'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Click "; sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif from " + self._getDataBaseWebsiteName() + " website"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='dialogErrorMessage errorMessage hidden'></span>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initFiltering : function(opts) { var self = this; var seqProperty = self._motifProperty.getPropertyByLabel(opts.motifSequenceProperty); var posProperty = self._motifProperty.getPropertyByLabel(opts.motifPositionProperty); var typeProperty = self._motifProperty.getPropertyByLabel(opts.typeProperty); var tripleList = LinkData.getTriplesByProperty(opts.workId, opts.fileName, seqProperty); $.each(tripleList, function(key, value) { var validPos = false; var validType = true; $.each(LinkData.getObjects(opts.workId, opts.fileName, value.subject, posProperty), function(posKey, posValue) { var tmpPos = parseInt(posValue); if (opts.baseSequenceMinLength < tmpPos && opts.baseSequence.length >= tmpPos) { validPos = true; } }); $.each(LinkData.getObjects(opts.workId, opts.fileName, value.subject, typeProperty), function(typeKey, typeValue) { if (opts.validType !== typeValue) { validType = false; } }); var valid = validPos && validType; if (valid && value.object.length > 0 && $.inArray(value.subject, self.filteredSubjectList) < 0) { self.filteredSubjectList.push(value.subject); } }); }, _initListener : function() { this._initSelectPropertyListener(); this._initReplaceButtonLitener(); }, _initSelectPropertyListener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; var property = self._motifProperty.getPropertyByLabel(self._options.sinePhaseProperty); $("#" + self._containerId + " ." + self._options.selectPropertyClass).change(function() { self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.resultAreaClass).show(); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).show(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); $("#" + self._containerId + " ." + self._options.databaseInfoClass).hide(); var range = $("option:selected", this).val(); if (range && range != -1) { var triple = self._getMotifMinCircadianTriple(workId, fileName, range); if (triple) { self._motifMinCircadianSequence(workId, fileName, triple.subject); self._initMotifSequenceListener(); } else { self._appSequence._showError(self._options.noSequenceForThisRange); $("#" + self._containerId + " ." + self._options.resultAreaClass).hide(); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); } } }); }, _initReplaceButtonLitener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; $("#" + self._containerId + " ." + self._options.replaceButtonClass).click(function() { self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); var seqs = []; $("#" + self._containerId + " .userSequence").each(function() { seqs.push($(this).text()); }); var seqVal = []; $("#" + self._containerId + " .userSequence .hdnSequence").each(function() { seqVal.push($(this).val()); }); var html = self._appSequence.replace(seqs); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(html); self._showDatabaseInfo(seqVal); self._options.callback(); }); }, _initMotifSequenceListener : function() { var self = this; $("#" + self._containerId + " .motifSequence").click(function() { $("." + self._options.motifViewDialogClass).hide(); var parent = $(this).closest('.userSequence'); var container = $(this).closest('.userSequence'); var seq = $(parent).find(".hdnSequence").val(); var pos = $(parent).find(".hdnPosition").val(); var seqEl = self._getSeqElBySeq(seq); var appropriatePos = (seqEl && seqEl.getAppropriatePos()) ? seqEl.getAppropriatePos() : pos; self._initSequencePopup(seqEl); $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass).hide(); $("#" + self._motifViewDialogId + " .sequence").val(seq); $("#" + self._motifViewDialogId + " .position").val(appropriatePos); $("#" + self._motifViewDialogId + " .minSeq").html(self._getMinPosition(seq)); $("#" + self._motifViewDialogId + " .maxSeq").html(self._getMaxPosition(seq)); self._initPositionInsert(seq, appropriatePos); $("#" + self._motifViewDialogId).dialog({title: self._default.motifViewDialogTitle + " - " + seq}); $("#" + self._motifViewDialogId).dialog("open"); $("#" + self._motifViewDialogId).closest('.' + self._options.motifViewDialogClass).show(); }); }, _initSequencePopup : function(seqEl) { var self = this; $("#" + self._motifViewDialogId + " .moreInfo").unbind("click"); var url = (seqEl && seqEl.getExternalUrl()) ? seqEl.getExternalUrl() : "#"; $("#" + self._motifViewDialogId + " .moreInfo").click(function() { var winWidth = 800; var winHeight = 800; var winLeft = parseInt((screen.availWidth/2) - (winWidth/2)); var winTop = parseInt((screen.availHeight/2) - (winHeight/2)); var winStyle = "width=" + winWidth + ",height=" + winHeight + ",left=" + winLeft + ",top=" + winTop + ",screenX=" + winLeft + ",screenY=" + winTop + ",scrollbars=1"; window.open(url, "Motif", winStyle); }); }, _initPositionInsert : function(seq, pos) { var self = this; var mod = seq.length % 2; $("#" + self._motifViewDialogId + " .position").unbind("keyup"); $("#" + self._motifViewDialogId + " .position").keyup(function() { var val = $(this).val(); if (isNaN(val)) { $(this).val(pos); return; } var tmpVal = new String(val); if (mod == 0) { if (tmpVal.indexOf(".") == -1) { $(this).val(tmpVal + ".5"); } else { $(this).val(tmpVal.split(".")[0] + ".5"); } } else { if (tmpVal.indexOf(".") > -1) { $(this).val(tmpVal.split(".")[0]); } } }); }, _initMotifViewDialog : function() { var self = this; $("#" + self._motifViewDialogId).dialog({ autoOpen: false, title: self._default.motifViewDialogTitle, width: 520, dialogClass : self._options.motifViewDialogClass, buttons : [ { text: "Replace", click : function() { var seq = $("#" + self._motifViewDialogId).find(".sequence").val(); var pos = $("#" + self._motifViewDialogId).find(".position").val(); var extraCopies = parseInt($("#" + self._motifViewDialogId).find(".extraCopies").val()); var basePairs = parseInt($("#" + self._motifViewDialogId).find(".basePairs").val()); var minPos = parseFloat($("#" + self._motifViewDialogId).find(".minSeq").html()); var maxPos = parseFloat($("#" + self._motifViewDialogId).find(".maxSeq").html()); if (minPos > pos || maxPos < pos) { $dialogError = $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass); $dialogError.html(self._options.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos)); $dialogError.show(); return; } self._replaceWithSequence(seq, pos, extraCopies, basePairs); $(this).dialog("close"); } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ] }); }, // Get triples of motif with minimum circadian amplitude _getMotifMinCircadianTriple : function(workId, fileName, range) { var self = this; var property = self._motifProperty.getPropertyByLabel(self._options.sinePhaseProperty); var amplitudeProperty = self._motifProperty.getPropertyByLabel(self._options.sineAmplitudeProperty); var triples = LinkData.getTriplesByProperty(workId, fileName, property); var arr = range.split("-"); var startValue = arr[0]; var endValue = arr[1]; // var maxIndex = -1; // var maxValue = -99999; var minIndex = -1; var minValue = 99999; $.each (triples, function(tKey, tValue) { var tmpVal = parseFloat(tValue.object); if ($.inArray(tValue.subject, self.filteredSubjectList) >= 0 && tmpVal >= startValue && tmpVal < endValue) { var amplitude = LinkData.getObjects(workId, fileName, tValue.subject, amplitudeProperty)[0]; // if (maxValue < amplitude) { // maxValue = amplitude; // maxIndex = tKey; // } if (minValue > amplitude) { minValue = amplitude; minIndex = tKey; } } }); // if (maxIndex != -1) { // return triples[maxIndex]; // } if (minIndex != -1) { return triples[minIndex]; } return; }, _getDataBaseWebsiteName : function() { var self = this; var fileName = self._options.fileName if (fileName.indexOf(self._options.websiteNameAtted) > -1) { return self._options.websiteNameAtted; } else if (fileName.indexOf(self._options.websiteNamePpdb) > -1) { return self._options.websiteNamePpdb; } else { return "UNKNOWN"; } }, _motifMinCircadianSequence : function(workId, fileName, subject) { var self = this, seqHtml = self._appSequence.getSequenceHtml(subject); var sb = []; sb[sb.length] = "<div class='baseSequence'>" + self._baseSequence + "</div>"; sb[sb.length] = seqHtml; $("#" + self._containerId + " ." + self._options.resultAreaClass).html(sb.join("")); if (seqHtml.length == 0) { $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); } }, _getMinPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 1 : 0.5; return self._default.baseSequenceMinLength + Math.floor(seq.length / 2) + tHold; }, _getMaxPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 0 : 0.5; return self._baseSequence.length - 1 - Math.floor(seq.length / 2) + tHold; }, _getSeqElBySeq : function(seq) { if (seq && seq.trim().length == 7) { return this._heptamer.getBySequence(seq); } else if (seq && seq.trim().length == 8) { return this._octamer.getBySequence(seq); } }, _showDatabaseInfo : function(seqVal) { var self = this, fileName = self._options.fileName, appName = self._options.appName; var propLabel = $("option:selected", "#" + self._containerId + " ." + self._options.selectPropertyClass).val(); var label = self._motifProperty.getPropertyNameByLabel(propLabel); label = (label && label.trim().length != 0) ? label : propLabel; var usedMotif = (seqVal.length != 0) ? seqVal.toString() : "-"; var dbInfoHtml = self._getDatabaseInfo(fileName, appName, label, usedMotif); $("#" + self._containerId + " ." + self._options.databaseInfoClass).html(dbInfoHtml); $("#" + self._containerId + " ." + self._options.databaseInfoClass).show(); }, _getDatabaseInfo : function(fileName, method, property, motif) { var sb = []; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Database</div>"; sb[sb.length] = "<div class='left'>" + fileName + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Application</div>"; sb[sb.length] = "<div class='left'>" + method + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Range</div>"; sb[sb.length] = "<div class='left'>" + property + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Motif</div>"; sb[sb.length] = "<div class='left'>" + motif + "</div>"; sb[sb.length] = "</div>"; return sb.join(""); }, _replaceWithSequence : function(seq, pos, extraCopies, basePairs) { var self = this; var html = self._appSequence.replaceWith(seq, pos, extraCopies, basePairs); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(html); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); self._showDatabaseInfo(seq); self._options.callback(); } }; // Application.motifProperty method Application.motifProperty = function() { this._init.apply(this, arguments); }; Application.motifProperty.prototype = { _options : null, _propMap : null, _nameMap : null, _default : { nameMappingNamespace : "http://atted.jp/help/slide_GeneExp_v3.shtml#", nameMappingProperty : "http://purl.org/dc/elements/1.1/title", propertyMappingExpression : "Expression", propertyMappingWorkUri : "http://linkdata.org/work" }, _init : function(options) { this._options = $.extend({}, this._default, options); this._propMap = []; this._nameMap = []; this._initPropMap(this._options); this._initNameMap(); }, _initPropMap : function(opts) { var self = this, workId = opts.workId, fileName = opts.fileName; $.each(LinkData.getProperties(workId, fileName), function(key, value) { var label = self._getLabel(value); if (!self._propMap[label]) { self._propMap[label] = value; } }); }, _initNameMap : function() { var self = this, nameKey; $.each(LinkData.getWorks(), function(workKey, workId) { $.each(LinkData.getFiles(workId), function(fileKey, fileName) { $.each(LinkData.getSubjects(workId, fileName), function(subKey, subValue) { nameKey = self._getNameKey(subValue); if (nameKey) { var nameArray = LinkData.getObjects(workId, fileName, subValue, self._options.nameMappingProperty); if (nameArray && nameArray.length > 0) { self._nameMap[nameKey] = nameArray[0]; } } }); }); }); }, _getNameKey : function(value) { var key; if (value && value.indexOf(this._options.nameMappingNamespace) >= 0) { key = value.split("#")[1]; } return key; }, _getLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, getOptionArray : function() { var self = this, list = new Object(); var workId = self._options.workId, fileName = self._options.fileName; $.each(LinkData.getProperties(workId, fileName), function(key, value) { if (value.indexOf(self._options.propertyMappingWorkUri) > -1 || value.indexOf(self._options.propertyMappingExpression) > -1) { var propLabel = self._getLabel(value); var name = self._nameMap[propLabel]; list[propLabel] = (name) ? name : propLabel; } }); return list; }, getPropertyByLabel : function(label) { return this._propMap[label]; }, getPropertyNameByLabel : function(label) { return this._nameMap[label]; } }; // Application.sequence method Application.sequence = function() { this._init.apply(this, arguments); }; Application.sequence.prototype = { CHAR_SEQ_EMPTY : "-", _options : null, _workId : null, _fileName : null, _seqProperty : null, _posProperty : null, _baseSequence : null, _sequenceList : null, _positionList : null, _containerId : null, _errorContainerClass : null, _outOfRangeArray : null, _default : { msgInvalidSequence: "invalid sequence.", msgOutOfRangeSequence: "out of range sequence : {0}", }, _init : function(options) { this._options = options; this._workId = this._options.workId; this._fileName = this._options.fileName; this._seqProperty = this._options.motifSequenceProperty; this._posProperty = this._options.motifPositionProperty; this._baseSequence = this._options.baseSequence; this._containerId = this._options.containerId; this._errorContainerClass = this._options.errorMessageClass; }, _getCustomSequenceHtml : function(baseSequence, sequence, position) { var seqLen = sequence.length; var tHold = Math.floor(seqLen / 2) + 1; var pos = parseInt(position); var baseSeqLen = baseSequence.length; var suffixLen = baseSeqLen - tHold - pos; var sb = []; if (pos > this._options.baseSequenceMinLength && suffixLen > 0) { for (var i = 0; i < suffixLen; i++) { sb.push(this.CHAR_SEQ_EMPTY); } sb.push("<a href='javascript:void(0)' class='motifSequence'>" + sequence + "</a>"); sb.push("<input type='hidden' class='hdnSequence' value='" + sequence + "'/>"); sb.push("<input type='hidden' class='hdnPosition' value='" + pos + "'/>"); } else { //_showError($appContainer, opts.msgOutOfRangeSequence.replace("{0}", sequence)); this._outOfRangeArray.push(sequence + "[" + pos + "]"); this._showError(this._default.msgOutOfRangeSequence.replace("{0}", this._outOfRangeArray.toString())); } return sb.join(""); }, _isValidSequenceList : function(seqs) { var count = seqs.length; var maxlength = 0; for (var i = 0; i < count; i++) { if (seqs[i].length > maxlength) { maxlength = seqs[i].length; } } var result = true; for (var i = 0; i < maxlength; i++) { var chars = []; for (var j = 0; j < count; j++) { chars.push(seqs[j].charAt(i)); } if (! this._isValidChars(chars.join(""))) { result = false; break; } } return result; }, _isValidChars : function(charString) { var charLen = charString.length; var result = true; var first = null; for (var i = 0; i < charLen; i++) { if (charString.charAt(i) == this.CHAR_SEQ_EMPTY) { continue; } if (! first) { first = charString.charAt(i); } var current = charString.charAt(i); if (current && first != current) { result = false; break; } } return result; }, _getReplacedCustomSequence : function(seqs) { var mergeSequence = this._getmergeCharSequence(seqs); var maxlength = this._baseSequence.length; var sb = []; for (var i = 0; i < maxlength; i++) { var bChar = this._baseSequence.charAt(i); var mChar = mergeSequence.charAt(i); if (mChar !== this.CHAR_SEQ_EMPTY) { // replaced sb.push(mChar); } else { sb.push(bChar); } } return sb.join(""); }, _getmergeCharSequence : function(seqs) { var count = seqs.length; var maxlength = this._baseSequence.length; var sb = []; for (var i = 0; i < maxlength; i++) { var chars = []; for (var j = 0; j < count; j++) { chars.push(seqs[j].charAt(i) ? seqs[j].charAt(i) : this.CHAR_SEQ_EMPTY); } sb.push(this._getMergeChar(chars.join(""))); } return sb.join(""); }, _getMergeChar : function(charString) { var charLen = charString.length; var result = null; for (var i = 0; i < charLen; i++) { if (charString.charAt(i) !== this.CHAR_SEQ_EMPTY) { result = charString.charAt(i); break; } } if (!result) { result = this.CHAR_SEQ_EMPTY; } return result; }, _wrappedReplacedSequenceHtml : function(replaceSequence, seqs) { var mergeSequence = this._getmergeCharSequence(seqs); var length = this._baseSequence.length; var sb = []; for (var i = 0; i < length; i++) { var bChar = this._baseSequence.charAt(i); var rChar = replaceSequence.charAt(i); var mChar = mergeSequence.charAt(i); var seqChar = (bChar !== rChar) ? "<span class='replace'>" + rChar + "</span>" : rChar; if (mChar !== this.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence'>" + seqChar + "</span>"); } else { sb.push(seqChar); } } return sb.join(""); }, _showError : function(message) { $errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass); $errorMessageContainer.html(message); $errorMessageContainer.show(); }, getSequenceHtml : function(subject) { var self = this; self._outOfRangeArray = []; var sequenceList = LinkData.getObjects(self._workId, self._fileName, subject, self._seqProperty); var positionList = LinkData.getObjects(self._workId, self._fileName, subject, self._posProperty); var sb = [], baseSequence = self._baseSequence; for (var i = 0; i < sequenceList.length; i++) { var customSeqString = this._getCustomSequenceHtml(baseSequence, sequenceList[i], positionList[i]); if (customSeqString.length > 0) { sb.push("<div class='userSequence'>" + customSeqString + "</div>"); } } return sb.join("\n"); }, replace : function(seqs) { var isValid = this._isValidSequenceList(seqs); if (isValid) { if (seqs.length > 0) { var replaceSeq = this._getReplacedCustomSequence(seqs); var replaceSeqHtml = this._wrappedReplacedSequenceHtml(replaceSeq, seqs); return replaceSeqHtml; } } else { //$appContainer.find("." + opts.appReplaceResultAreaContainerClz).hide(); //_showError($appContainer, opts.msgInvalidSequence); this._showError(this._default.msgInvalidSequence); } }, replaceWith : function(seq, pos, extraCopies, basePairs) { var main = []; var seqLen = seq.length; var tHold = Math.floor(seqLen / 2) + 1; var pos = parseInt(pos); var baseSeqLen = this._baseSequence.length; var len = baseSeqLen - tHold - pos; for (var j = 0; j < extraCopies + 1; j++) { var array = []; for (var i = 0; i < len; i++) { array.push(this.CHAR_SEQ_EMPTY); } array.push(seq); main.push(array.join("")); len = len - seqLen - basePairs; if (len < 0) { break; } } return this.replace(main); }, hideError : function() { $errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass).hide(); } }; // Application.heptamer method Application.heptamer = function() { this._init.apply(this, arguments); }; Application.heptamer.prototype = { _heptamerMap : null, _default : { filterSubjectUrlPhrase : "http://atted.jp/data/cis/", filterSequencePropertyPhrase : "motif%20sequence", filterMaxCEGPropertyPhrase : "maxCEG", filterAppropriatePosition : "Appropriateposition(%C2%B1%2040%20bp)" }, _init : function() { this._heptamerMap = new Object(); this._initHeptamerList(); }, _initHeptamerList : function() { var self = this; $.each(LinkData.getWorks(), function(workKey, workId) { $.each(LinkData.getFiles(workId), function(fileKey, fileName) { $.each(LinkData.getSubjects(workId, fileName), function(subKey, subValue) { if (self._isHeptamerSubject(subValue)) { var triples = LinkData.getTriplesBySubject(workId, fileName, subValue); //var obj = self._getObjectByTriple(triples); var seqEl = self._getObjectByTriple(triples); var seq = seqEl.getSequence(); if (seq && seq.trim().length != 0) { seqEl.setExternalUrl(subValue); //obj.url = subValue; self._heptamerMap[seq] = seqEl; } } }); }); }); }, _getObjectByTriple : function(triples) { var self = this; //var obj = {}; var seqEl = new Application.seqElement(); $.each(triples, function(key, value) { var property = value.property; if (property.indexOf(self._default.filterSequencePropertyPhrase) >= 0) { seqEl.setSequence(value.object); //obj.sequence = value.object; } else if (property.indexOf(self._default.filterAppropriatePosition) >= 0) { seqEl.setAppropriatePos(value.object); //obj.appropriatePos = value.object; } }); return seqEl; }, _isHeptamerSubject : function(subject) { var self = this; if (!subject) { return false; } if (subject.indexOf(self._default.filterSubjectUrlPhrase) > -1) { return true; } return false; }, getBySequence : function(sequence) { return this._heptamerMap[sequence]; } }; // Application.octamer method Application.octamer = function() { this._init.apply(this, arguments); }; Application.octamer.prototype = { _octamerMap : null, _default : { filterSubjectUrlPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/", filterSequencePropertyPhrase : "sequence", filterAppropriatePosition : "Appropriate%20position" }, _init : function() { this._octamerMap = new Object(); this._initOctamerList(); }, _initOctamerList : function() { var self = this; $.each(LinkData.getWorks(), function(workKey, workId) { $.each(LinkData.getFiles(workId), function(fileKey, fileName) { $.each(LinkData.getSubjects(workId, fileName), function(subKey, subValue) { if (self._isOctamerSubject(subValue)) { var triples = LinkData.getTriplesBySubject(workId, fileName, subValue); var seqEl = self._getObjectByTriple(triples); var seq = seqEl.getSequence(); if (seq && seq.trim().length != 0) { seqEl.setExternalUrl(subValue); //obj.url = subValue; self._octamerMap[seq] = seqEl; } } }); }); }); }, _getObjectByTriple : function(triples) { var self = this; //var obj = {}; var seqEl = new Application.seqElement(); $.each(triples, function(key, value) { var property = value.property; if (property.indexOf(self._default.filterSequencePropertyPhrase) >= 0) { seqEl.setSequence(value.object); //obj.sequence = value.object; } else if (property.indexOf(self._default.filterAppropriatePosition) >= 0) { seqEl.setAppropriatePos(value.object); //obj.appropriatePos = value.object; } }); return seqEl; }, _isOctamerSubject : function(subject) { var self = this; if (!subject) { return false; } if (subject.indexOf(self._default.filterSubjectUrlPhrase) > -1) { return true; } return false; }, getBySequence : function(sequence) { return this._octamerMap[sequence]; } }; // Application.seqElement method Application.seqElement = function() { this._init.apply(this, arguments); }; Application.seqElement.prototype = { _externalUrl : null, _sequence : null, _appropriatePos : null, _init : function() {}, getExternalUrl : function() { return this._externalUrl; }, setExternalUrl : function(externalUrl) { this._externalUrl = externalUrl; }, getSequence : function() { return this._sequence; }, setSequence : function(sequence) { this._sequence = sequence; }, getAppropriatePos : function() { return this._appropriatePos; }, setAppropriatePos : function(appropriatePos) { this._appropriatePos = appropriatePos; } }; // Main function $(document).ready(function() { var containerId = "container"; // Set work ID, file name, and base sequence var options = { workId : "rdf1s288i", fileName : "DiurnalHours_ATTED_COL_LDHH", baseSequence : "GAAAAAAGACGTTCCAACCACGTCTTCAAAGCAAGTGATTGGATTAAGGTTCTTCCACACGGTAAGGGATGGCACTAACACCTACCATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC" }; // Application.motifMinCircadian method new Application.motifMinCircadian(containerId, options); });
body { font-family: sans-serif; font-size: 14px; } a { color: #3B5998; font-weight: bold; text-decoration: none; } .hidden { display:none; } .left { float: left; } .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; min-width: 125px; } .row { padding: 5px 0; } .row:after { content: ""; clear: left; display: block; } .row input[type="text"] { width: 200px; } .highlight-sequence { font-weight: bold; } .resultArea { font-family: "Courier New","Lucida Console"; margin: 10px 0; min-width: 410px; overflow: auto; width: 100%; background-color: #FFFFFF; border: 1px solid #DDDDDD; word-wrap: break-word; } .replaceSequence { background-color: #FFFFFF; border: 1px solid #DDDDDD; margin: 10px 0 0; font-family: "Courier New","Lucida Console"; } .replace { color: #E80010; } .errorMessage { color: #FF0000; text-align: center; } /** * button css */ .actionBtn { border: 1px solid #DDDDDD; cursor: pointer; display: inline-block; font-weight: bold; padding: 5px 2px; text-align: center; width: 25px; } .actionBtn:hover { border: 1px solid #000000; } .btn { display: inline-block; *display: inline; /* IE7 inline-block hack */ *zoom: 1; padding: 4px 10px 4px; margin-bottom: 0; font-size: 13px; line-height: 18px; color: #333333; text-align: center; text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75); vertical-align: middle; background-color: #f5f5f5; background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6); background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6)); background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6); background-image: -o-linear-gradient(top, #ffffff, #e6e6e6); background-image: linear-gradient(top, #ffffff, #e6e6e6); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0); border-color: #e6e6e6 #e6e6e6 #bfbfbf; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); border: 1px solid #cccccc; border-bottom-color: #b3b3b3; -webkit-border-radius: 4px; -moz-border-radius: 4px; border-radius: 4px; -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); cursor: pointer; *margin-left: .3em; } .btn:hover, .btn:active, .btn.active, .btn.disabled, .btn[disabled] { background-color: #e6e6e6; } .btn:hover { color: #333333; text-decoration: none; background-color: #e6e6e6; background-position: 0 -15px; -webkit-transition: background-position 0.1s linear; -moz-transition: background-position 0.1s linear; -ms-transition: background-position 0.1s linear; -o-transition: background-position 0.1s linear; transition: background-position 0.1s linear; } .btn-blue, .btn-blue:hover, .btn-yellow, .btn-yellow:hover, .btn-red, .btn-red:hover, .btn-green, .btn-green:hover, .btn-lightblue, .btn-lightblue:hover, .btn-black, .btn-black:hover { text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25); color: #ffffff; } .btn-blue { background-color: #0074cc; background-image: -moz-linear-gradient(top, #0088cc, #0055cc); background-image: -ms-linear-gradient(top, #0088cc, #0055cc); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc)); background-image: -webkit-linear-gradient(top, #0088cc, #0055cc); background-image: -o-linear-gradient(top, #0088cc, #0055cc); background-image: linear-gradient(top, #0088cc, #0055cc); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0); border-color: #0055cc #0055cc #003580; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-blue:hover, .btn-blue:active, .btn-blue.active, .btn-blue.disabled, .btn-blue[disabled] { background-color: #0055cc; } .btn-green { background-color: #5bb75b; background-image: -moz-linear-gradient(top, #62c462, #51a351); background-image: -ms-linear-gradient(top, #62c462, #51a351); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351)); background-image: -webkit-linear-gradient(top, #62c462, #51a351); background-image: -o-linear-gradient(top, #62c462, #51a351); background-image: linear-gradient(top, #62c462, #51a351); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0); border-color: #51a351 #51a351 #387038; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-green:hover, .btn-green:active, .btn-green.active, .btn-green.disabled, .btn-green[disabled] { background-color: #51a351; } .btn-green:active, .btn-green.active { background-color: #408140 ¥9; } .btn-lightblue { background-color: #49afcd; background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4); background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4)); background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4); background-image: -o-linear-gradient(top, #5bc0de, #2f96b4); background-image: linear-gradient(top, #5bc0de, #2f96b4); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0); border-color: #2f96b4 #2f96b4 #1f6377; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-lightblue:hover, .btn-lightblue:active, .btn-lightblue.active, .btn-lightblue.disabled, .btn-lightblue[disabled] { background-color: #2f96b4; } /* Dialog css */ .motifViewDialog .explanation { color: #AAAAAA; font-size: 12px; } .motifViewDialog .moreInfo { color: #3B5998; cursor: pointer; } .motifViewDialog .basePairs, .motifViewDialog .extraCopies, .motifViewDialog .position { width: 70px; } .motifViewDialog .dialogErrorMessage { font-size: 12px; } .ui-corner-all, .ui-corner-top, .ui-corner-left, .ui-corner-tl { border-top-left-radius: 1px; } .ui-corner-all, .ui-corner-top, .ui-corner-right, .ui-corner-tr { border-top-right-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-left, .ui-corner-bl { border-bottom-left-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-right, .ui-corner-br { border-bottom-right-radius: 1px; }
<div id="container"></div>
実行画面
入力データ
概要
保存した実行結果
データ作品
テーブルデータ
GenoCon2 Challenge A - Circadian Coexpression (DIURNAL + ATTED-II promoter motif)
作者:GenoCon
更新日:2012年9月19日
8504 ダウンロード, 10 アプリケーション
Circadian Data collected over two days (44 hours) at four hour intervals in various growth conditions. We calculated the Phase of each data by non-linear best fit to a sine wave with a 24 hour period, and similarly calculated the Amplitude. Visually checking the 1000 largest amplitude genes showed a good fit in all cases, though a few genes clearly deviated from sinusoidal behavior. All had a major period of 24 hours. For each gene locus, we added the CEG motifs as calculated by ATTED-II. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for DIURNAL)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/18419293">http://www.ncbi.nlm.nih.gov/pubmed/18419293</a>
DiurnalHours_ATTED_COL_LDHH
DiurnalHours_ATTED_COL_SD
DiurnalHours_ATTED_DD_DDHC
DiurnalHours_ATTED_LDHC
DiurnalHours_ATTED_LDHH_SM
DiurnalHours_ATTED_LDHH_ST
DiurnalHours_ATTED_LER_SD
DiurnalHours_ATTED_LIGHT5_HIF138_13
DiurnalHours_ATTED_LIGHT5_HIF138_8
DiurnalHours_ATTED_LIGHT5_znknOX
DiurnalHours_ATTED_LL12_LDHH
DiurnalHours_ATTED_LL23_LDHH
DiurnalHours_ATTED_LLHC
DiurnalHours_ATTED_LL_LDHC
DiurnalHours_ATTED_LL_LLHC
DiurnalHours_ATTED_lhyox_SD
DiurnalHours_ATTED_longday
DiurnalHours_ATTED_lux_2_LDHH
DiurnalHours_ATTED_phyB9_SD
DiurnalHours_ATTED_shortday
データ作品を追加する
Link http://app.linkdata.org/run/app1s107i?tab=readme
Initial content
jquery-1.7.1.min.js
jquery-ui-1.8.18.min.js
Work
追加
クリア
insert work id or work name.